Specifications

Variant Details
Catalog IDHP210118Supplier Catalog IDHP210118
Size200 ReactionsPrice N/A
Supplier N/A Package Content qPCR primer pairs against Homo sapiens gene CBX5
General
Shelf Life12 monthsGenBank Accession No.NM_001127321 | NM_001127322 | NM_012117 | BC006821 | BC030149 | BC047432 | BP236173 | BP336150
Additional InformationThe primer mix has been tested to generate satisfactory qPCR data on ABI 7900HTPreservation Temperature-20°C
Recognition Site 5'-3'GTTCCAGTCCTCTCTCAAAGCCRecognition Site 3'-5'GAGAAGTCAGAAAGTAACAAGAGG
Gene ID23468.0

Description

Currently, no description is available.

For research use only.