Specifications

Variant Details
Catalog IDHP214221Supplier Catalog IDHP214221
Size200 ReactionsPrice N/A
Supplier N/A Package Content qPCR primer pairs against Homo sapiens gene MMP26
General
Shelf Life12 monthsGenBank Accession No.NM_021801 | BC101543 | BC101541
Additional InformationThe primer mix has been tested to generate satisfactory qPCR data on ABI 7900HTPreservation Temperature-20°C
Recognition Site 5'-3'GTAGGTCTGTCCCATTCCGATGRecognition Site 3'-5'AGGATGGGACTTTGTTGAGGGC
Gene ID56547.0

Description

Currently, no description is available.

For research use only.